View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4370-Insertion-8 (Length: 90)
Name: NF4370-Insertion-8
Description: NF4370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4370-Insertion-8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 71; Significance: 9e-33; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 71; E-Value: 9e-33
Query Start/End: Original strand, 7 - 89
Target Start/End: Original strand, 2110067 - 2110149
Alignment:
| Q |
7 |
aaatggaacggccatttgaacatgaataatgcctagcaaaaaacatgaccatctttgatctcttgcaaatataaatcggaaca |
89 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2110067 |
aaatggaactgccatttgaacatgaataatgcctaacaaaaaacatgatcatctttgatctcttgcaaatataaatcggaaca |
2110149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University