View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4370_low_3 (Length: 223)
Name: NF4370_low_3
Description: NF4370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4370_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 43588257 - 43588455
Alignment:
| Q |
1 |
ttcaattaattaaagtttaagtgaagtgagtggctagattcactaagtcgggacaggcgttaaagttctaaattctaatagtattgacaaaagtatttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| ||||||||||||| | |
|
|
| T |
43588257 |
ttcaattaattaaagtttaagtgaagtgagtggctatattcactaagtcgggacaggcgttaaagttct-------aatagtatagacaaaagtatttgt |
43588349 |
T |
 |
| Q |
101 |
agattgtcattagcaaaagtttaatactaacaacaaaattaaatcattttaaagaatgaaacaatttcttatcaaatgccctgcacctatatctattgct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43588350 |
agattgtcattagcaaaagtttaatactaacaacaaaattaaatcattttaaagaatgaaacaatttcttatcaaatgccctgcacctatatctattgct |
43588449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University