View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4370_low_5 (Length: 201)
Name: NF4370_low_5
Description: NF4370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4370_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 18 - 179
Target Start/End: Original strand, 43186018 - 43186179
Alignment:
| Q |
18 |
acctgtgaagagcacaagcctggcacttgttgcnnnnnnnctctaacctctggaaaacctacatcgcagagcggaaaatggttgctaactcaacatttct |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
43186018 |
acctgtgaagagcacaagcctggcacttgttgcaaaaaacctctaacctctggaaaacctacatcgcagagtggaaaatggttgctaagtcaacatttct |
43186117 |
T |
 |
| Q |
118 |
tcagatgttatgaagctaaaacaaccactaacatcttagcaattggttttttcaattggtaa |
179 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43186118 |
tcagatgttatgaagctgaaacaaccactaacatcttagcaattggttttttcaattggtaa |
43186179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University