View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4371_high_3 (Length: 383)
Name: NF4371_high_3
Description: NF4371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4371_high_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 139; Significance: 1e-72; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 28 - 174
Target Start/End: Complemental strand, 35021847 - 35021701
Alignment:
| Q |
28 |
cacgtgcgatggagcggttagtagcgatgtgagtgacgaggtagttggggattgtgaggaagagggagatgttggtgtagagaagagaacggattatgga |
127 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35021847 |
cacgtgcgatggagcggttagtggcgatgggagtgacgaggtagttggggattgtgaggaagagggagatgttggtgtagagaagagaacggattatgga |
35021748 |
T |
|
| Q |
128 |
tgggtcgggttcttcgagacggaggtgagtgagtttgagattttgca |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35021747 |
tgggtcgggttcttcgagacggaggtgagtgagtttgagattttgca |
35021701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 246 - 286
Target Start/End: Complemental strand, 35021638 - 35021598
Alignment:
| Q |
246 |
tatgtgacgccgattgtggggagggaggtggtggttgttgg |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35021638 |
tatgtgacgccgattgtggggagggaggtggtggttgttgg |
35021598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 330 - 359
Target Start/End: Complemental strand, 35021554 - 35021525
Alignment:
| Q |
330 |
atcatgaaggtactgtgatgaaacatgatg |
359 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
35021554 |
atcatgaaggtactgtgatgaaacatgatg |
35021525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University