View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4372-Insertion-11 (Length: 71)
Name: NF4372-Insertion-11
Description: NF4372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4372-Insertion-11 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 61; Significance: 6e-27; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 61; E-Value: 6e-27
Query Start/End: Original strand, 3 - 71
Target Start/End: Original strand, 1488258 - 1488326
Alignment:
| Q |
3 |
caacatgatgaagatgaaaatggattgtagtttcatggtggatgatatgctagtgttgatggttcatgg |
71 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1488258 |
caacatggtgaagatgaaaatggattgtagtttcatggtggatgagatgctagtgttgatggttcatgg |
1488326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 61; Significance: 6e-27; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 61; E-Value: 6e-27
Query Start/End: Original strand, 3 - 71
Target Start/End: Original strand, 50306296 - 50306364
Alignment:
| Q |
3 |
caacatgatgaagatgaaaatggattgtagtttcatggtggatgatatgctagtgttgatggttcatgg |
71 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
50306296 |
caacatggtgaagatgaaaatggattgtagtttcatggtggatgagatgctagtgttgatggttcatgg |
50306364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 61; Significance: 6e-27; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 61; E-Value: 6e-27
Query Start/End: Original strand, 3 - 71
Target Start/End: Complemental strand, 3788710 - 3788642
Alignment:
| Q |
3 |
caacatgatgaagatgaaaatggattgtagtttcatggtggatgatatgctagtgttgatggttcatgg |
71 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3788710 |
caacatggtgaagatgaaaatggattgtagtttcatggtggatgagatgctagtgttgatggttcatgg |
3788642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 57; Significance: 2e-24; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 57; E-Value: 2e-24
Query Start/End: Original strand, 3 - 71
Target Start/End: Original strand, 26021684 - 26021752
Alignment:
| Q |
3 |
caacatgatgaagatgaaaatggattgtagtttcatggtggatgatatgctagtgttgatggttcatgg |
71 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
26021684 |
caacatggtgaagatgaaaatggattgtagtttcatgatggatgagatgctagtgttgatggttcatgg |
26021752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University