View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4372-Insertion-8 (Length: 309)

Name: NF4372-Insertion-8
Description: NF4372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4372-Insertion-8
NF4372-Insertion-8
[»] chr3 (2 HSPs)
chr3 (178-253)||(28677084-28677159)
chr3 (41-83)||(28676185-28676227)


Alignment Details
Target: chr3 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 178 - 253
Target Start/End: Original strand, 28677084 - 28677159
Alignment:
178 ttttatattgacattaatcacaactcttcaaatgatcatattatatcggggtaactaggtttcaatctttatcaat 253  Q
    ||||||||||||||||||||||||||||||| || ||||||||||| |||||||||| ||||||||||||||||||    
28677084 ttttatattgacattaatcacaactcttcaattggtcatattatattggggtaactaagtttcaatctttatcaat 28677159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 41 - 83
Target Start/End: Original strand, 28676185 - 28676227
Alignment:
41 tctctccttctatcacaccaccaaactatcacatttattgcat 83  Q
    |||||||||||||||||||||||||||||||||||||||||||    
28676185 tctctccttctatcacaccaccaaactatcacatttattgcat 28676227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University