View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4373_low_6 (Length: 362)
Name: NF4373_low_6
Description: NF4373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4373_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 93 - 356
Target Start/End: Complemental strand, 46942743 - 46942479
Alignment:
| Q |
93 |
tattaaatgaaatcgattacactgatttgagacgacatcgttgaattggcaatgattctccacaatatcaagtatagcaatgagactacattcttattga |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46942743 |
tattaaatgaaatcgattacactgatttgagacgacat-gttgaattggcaatgattctccacaatatcaagtatagcaatgagactacattcttattga |
46942645 |
T |
|
| Q |
193 |
gattataaacaactttcatcattgattgaaatgaagaggtttcgaacattcttcatgaatcatgatccatgtaa--nnnnnnnnatggaaggactttatt |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
46942644 |
gattataaacaactttcatcattgattgaaatgaagaggtttcaaacattcttcatgaatcatgatccatgtaattttttttttatggaaggactttatt |
46942545 |
T |
|
| Q |
291 |
ccttttcttcgtacttgttaaaatgatctcctccgccttatcatttatgctaaccatattcttcga |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
46942544 |
ccttttcttcgtacttgttaaaatgatctcctccgccatatcatttatgctaaccattttcttcga |
46942479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University