View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4374_high_4 (Length: 349)
Name: NF4374_high_4
Description: NF4374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4374_high_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 1 - 338
Target Start/End: Complemental strand, 35535760 - 35535421
Alignment:
| Q |
1 |
agtacaatatcttttggtattgtactctagtatgaggaatgaaaaaccatttatatctctatataaaatt--gagattgaactatgattggcaggaaaca |
98 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
35535760 |
agtacaatatcttttggtattgcactctagtatgaggaatgaaaagccatttatatctctatataaaattctgagattgaactatgattggcaggaaaca |
35535661 |
T |
|
| Q |
99 |
tagagtttgtcgatgacataatgacatttgaggagcttggcattttcctgaaatcccgtggatgtcatgtggctatgctttcatcaatggagttttcatt |
198 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||||||||| ||| ||||||||| ||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
35535660 |
tagagtttgttgatgacataatgacatttgaagagcttggcatattcttgaaatcccatggatgtcatgtggctatgctttcatcaatggagttttcgtt |
35535561 |
T |
|
| Q |
199 |
gaaaaatggaattgctggttgcttgaaagctttattgcgagagtttctagggaattctttcgatgtgggtgcttctatgaacttattatgtataattaaa |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35535560 |
gaaaaatggaattgctggttgcttgaaagctttattgcgagagtttctagggaattctttcgatgtgggtgcttctatgaacttattatgtataattaaa |
35535461 |
T |
|
| Q |
299 |
ttaaatctatctactgccactgtctcctttacttattcat |
338 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35535460 |
ttaaatctatctactgctactgtctcctttacttattcat |
35535421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University