View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4375-Insertion-6 (Length: 935)
Name: NF4375-Insertion-6
Description: NF4375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4375-Insertion-6 |
 | |
|
| [»] scaffold0023 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0023 (Bit Score: 406; Significance: 0; HSPs: 2)
Name: scaffold0023
Description:
Target: scaffold0023; HSP #1
Raw Score: 406; E-Value: 0
Query Start/End: Original strand, 8 - 437
Target Start/End: Complemental strand, 112144 - 111715
Alignment:
| Q |
8 |
catttatggttaggtttaaacaacggtgagacaggttggtttttcgtcgcaatcatcgaaattatcattcaagaaggctttcatgcgtaagtatgtacaa |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
112144 |
catttatggttaggtttaaacaacggtgagacaggttagtttttcgtcgcaatcatcgaaattatcattcaagaaggctttcatgcgtaagtatgtacaa |
112045 |
T |
|
| Q |
108 |
gagaagcaacgactgaaattatcattcaaaaaggcattcaggtagggtacttttcaggtatatgctacttactatatttctaatatatctgaacatctac |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
112044 |
gagaagcaacgactgaaattatcattcaaaaaggcattcaggtagggtacttttctagtatctgctacttactatatttctaatatatctgaacatctac |
111945 |
T |
|
| Q |
208 |
aatatgttaagttgagaaggggatttgagatttatggtatactatgtgaagtttatctctcaaggaattggaatgctcgaggtcaaatatttcattttgc |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
111944 |
aatatgttaagttgagaaggggatttgagatttatggtatactatgtgaagtttatctctcaaggaattgaaatgctcgaggtcaaatatttcattttgc |
111845 |
T |
|
| Q |
308 |
taaatttatcaaggtttgggatataaagctcttaataatgtctattattgagataataggttgtttgcgaacgttgttaaatttgataggtttgttaaaa |
407 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
111844 |
taaatttatcaaggtttgggatataaagctcttaataatgtctattattgagataataggttgtttgcgaacgttgttaaatttgataggtttgttaaaa |
111745 |
T |
|
| Q |
408 |
atgttggacggaggttaggatagggagagg |
437 |
Q |
| |
|
|| ||||||||||||||||||||||||||| |
|
|
| T |
111744 |
atattggacggaggttaggatagggagagg |
111715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0023; HSP #2
Raw Score: 330; E-Value: 0
Query Start/End: Original strand, 518 - 910
Target Start/End: Complemental strand, 111450 - 111060
Alignment:
| Q |
518 |
atggtattttaaaggaaaacatgtattggagagggtgaaggaggaagcattaaggagtgacgaggaatgggaaaaggtgagggaggcaaaggagagggga |
617 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
111450 |
atggtattttaaaggaaaacatgtattggagagggtgaaggaggaagcattaaggagtgacgaggaatgggaaaaggtgagggaggcaaaggagagggga |
111351 |
T |
|
| Q |
618 |
gggatgggtgtggtgaatggagataaggttgaagtggaggtcgggagcaaagttcatgggggaggatttatgtatggaaaagtcacaaggaacggagacg |
717 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| ||||| ||||| ||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
111350 |
gggatgggtgtggtgaatggggataaggttgaagtggaggtc-ggagcgaagtttatgggggaggacttatgtatggaaaagtcacaaggaacggagacg |
111252 |
T |
|
| Q |
718 |
gtatgtttcaggtatttgcctttacatgagggatatagcttggtgctctagagctttgacagctagaattttgaaatggtctttttgttctagtgctaca |
817 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
111251 |
gtatgtttcaagtatttgcctttacatga-ggatatagcttggtgttctagagctttgacagctagaa-tttgaaatggtctttttgttctagtgctaca |
111154 |
T |
|
| Q |
818 |
acaaactatcttggatgctggttttttgaatttgaagatattctccatagga-ggaaaaataagttttttctatcttattggtgatgtggattt |
910 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
111153 |
acaaactatcttggatgctggttttttgaatttgaagataatctccttaggagggaaaaataagttttttctatcttattggtgatgtggattt |
111060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University