View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4375_low_10 (Length: 247)
Name: NF4375_low_10
Description: NF4375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4375_low_10 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 18 - 247
Target Start/End: Complemental strand, 40069502 - 40069279
Alignment:
| Q |
18 |
tgaaagactatccacattgcttaattgctctctcaaatcatcattctccaatctctgaaacattattcataattatcatatcattaaaaatgtttaaatt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40069502 |
tgaaagactatccacattgcttaattgctctctcaaatcatcattgtccaatctctgaaacattattcataattatcatatcattaaaaatgtttaaatt |
40069403 |
T |
 |
| Q |
118 |
taatcatagttaattctaaagttgcacttgcacatatgattggttatgatacgctaatggtataaaactttttagattgaccatatgacatgattaaact |
217 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
40069402 |
taatcatagttaattctaaagttgcatttgcacatatgattggttatgatac------ggtataaaactttttaaattgaccatgtgacatgattaaact |
40069309 |
T |
 |
| Q |
218 |
cgtgaatatagtacttacatttcgttttcc |
247 |
Q |
| |
|
||| ||||||||||||||||||||||||| |
|
|
| T |
40069308 |
ggtgtatatagtacttacatttcgttttcc |
40069279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 100 - 140
Target Start/End: Original strand, 31179441 - 31179481
Alignment:
| Q |
100 |
attaaaaatgtttaaatttaatcatagttaattctaaagtt |
140 |
Q |
| |
|
||||||||||||||| |||||| ||||||| |||||||||| |
|
|
| T |
31179441 |
attaaaaatgtttaactttaattatagttatttctaaagtt |
31179481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University