View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4375_low_11 (Length: 239)
Name: NF4375_low_11
Description: NF4375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4375_low_11 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 25 - 239
Target Start/End: Complemental strand, 43219521 - 43219307
Alignment:
| Q |
25 |
ccgccattcttctctgaagatttgaagatttacgctgggaatttgactcaagataccgatgttgaggaattgaaaacactttttgggcaggctgggactg |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43219521 |
ccgccattcttctctgaagatttgaagatttacgctgggaatttgactcaagataccgatgttgaggaattgaaaacactttttgggcaggctgggactg |
43219422 |
T |
 |
| Q |
125 |
taatgcatgctgaggtgagtagtccttatctttttatttcattaaatagattatgtgtaatatttggtgttacattctattataatttctcccgactaaa |
224 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43219421 |
tagtgcatgctgaggtgagtagtccttatctttttatttcattacatagattatgtgtaatatttggtgttacattctattataatttctcccgactaaa |
43219322 |
T |
 |
| Q |
225 |
ctatatgcaaaagtt |
239 |
Q |
| |
|
||||| ||||||||| |
|
|
| T |
43219321 |
ctataagcaaaagtt |
43219307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University