View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4375_low_13 (Length: 222)

Name: NF4375_low_13
Description: NF4375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4375_low_13
NF4375_low_13
[»] chr7 (1 HSPs)
chr7 (2-205)||(33269627-33269830)
[»] chr6 (1 HSPs)
chr6 (22-201)||(10032785-10032964)
[»] chr4 (1 HSPs)
chr4 (24-138)||(40378031-40378145)
[»] chr3 (1 HSPs)
chr3 (38-147)||(51752500-51752609)


Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 2 - 205
Target Start/End: Original strand, 33269627 - 33269830
Alignment:
2 cattatttgtgtatctgtgctgcagttggaagagaaattgttgaactatgcctcgaccgtatcagaaaattagcagacaattgcactggattgcaaggat 101  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
33269627 cattatttgtgtatctgtgctgcagttggaagagaaattgttgaactatgcctcgatcgtatcagaaaattagcagacaattgcactggattgcaaggat 33269726  T
102 tctttgttttcaatgctgttggtggaggtactggttctggtttgggatcattacttttggaaaggttgtctgttgattatggcaaaaagtctaaacttgg 201  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| |||||    
33269727 tctttgttttcaatgctgttggtggaggtactggttctggtttgggatcgttacttttggaaaggttgtctgtcgattatggcaaaaagtctaagcttgg 33269826  T
202 tttt 205  Q
    ||||    
33269827 tttt 33269830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 22 - 201
Target Start/End: Complemental strand, 10032964 - 10032785
Alignment:
22 tgcagttggaagagaaattgttgaactatgcctcgaccgtatcagaaaattagcagacaattgcactggattgcaaggattctttgttttcaatgctgtt 121  Q
    ||||||||||| | || |||  |||||||||||||| || ||| |||||||||| || ||||||||||| ||||||||||| || ||||| |||||||||    
10032964 tgcagttggaaaacaagttgaagaactatgcctcgatcgaatccgaaaattagctgaaaattgcactggcttgcaaggatttttggtttttaatgctgtt 10032865  T
122 ggtggaggtactggttctggtttgggatcattacttttggaaaggttgtctgttgattatggcaaaaagtctaaacttgg 201  Q
    || || || |||||||||||||| |||||||||||| | || || || ||||| |||||||| |||||||| ||||||||    
10032864 ggcggtggaactggttctggtttaggatcattacttcttgagagattatctgtagattatgggaaaaagtcaaaacttgg 10032785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 24 - 138
Target Start/End: Complemental strand, 40378145 - 40378031
Alignment:
24 cagttggaagagaaattgttgaactatgcctcgaccgtatcagaaaattagcagacaattgcactggattgcaaggattctttgttttcaatgctgttgg 123  Q
    ||||||||| ||||||||||||  ||||| | ||||| ||||||||  | |||||||| ||||||||  | ||||| ||  | |||||||||||||| ||    
40378145 cagttggaaaagaaattgttgatgtatgcttggaccgcatcagaaagcttgcagacaactgcactggtctccaaggctttctggttttcaatgctgtagg 40378046  T
124 tggaggtactggttc 138  Q
    |||||| ||||||||    
40378045 tggaggcactggttc 40378031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 38 - 147
Target Start/End: Complemental strand, 51752609 - 51752500
Alignment:
38 attgttgaactatgcctcgaccgtatcagaaaattagcagacaattgcactggattgcaaggattctttgttttcaatgctgttggtggaggtactggtt 137  Q
    |||||||| |||||||||||| | ||| ||||  ||||||| || || |||||  ||||||| ||||| || ||||||||||| ||||| || || || |    
51752609 attgttgatctatgcctcgacaggatccgaaagctagcagataactgtactggtctgcaaggtttcttggtgttcaatgctgtgggtggtggaaccggat 51752510  T
138 ctggtttggg 147  Q
    ||||||||||    
51752509 ctggtttggg 51752500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University