View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4375_low_9 (Length: 250)
Name: NF4375_low_9
Description: NF4375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4375_low_9 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 12 - 250
Target Start/End: Original strand, 40068964 - 40069202
Alignment:
| Q |
12 |
tattctggcaagtttattaagcaaatatggttaatttctagctttctttcttataatctagttgcaagataactgaattaaattaaatgtctgcatatgt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40068964 |
tattctggcaagtttattaagcaaatatggttaatttctagctttctttcttataatctagttgcaagataactgaattaaattaaatgtctgcatatgt |
40069063 |
T |
 |
| Q |
112 |
atctaagcaaataatgtatcatatatttgcaggtaaacaatgcagggattaatttcaattttgggtctgataattcagttgaaaatgctcatacggttat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40069064 |
atctaagcaaataatgtatcatatatttgcaggtaaacaatgcagggattaatttcaattttgggtctgataattcagttgaaaatgctcatacggttat |
40069163 |
T |
 |
| Q |
212 |
tgatacgaattattttggaaccaaacgtatgattgaagc |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40069164 |
tgatacgaattattttggaaccaaacgtatgattgaagc |
40069202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 140 - 225
Target Start/End: Original strand, 10898717 - 10898802
Alignment:
| Q |
140 |
gcaggtaaacaatgcagggattaatttcaattttgggtctgataattcagttgaaaatgctcatacggttattgatacgaattatt |
225 |
Q |
| |
|
|||||| |||||||| || ||||||||||| | ||||||||||| || ||||||||||||| | ||||||||| || ||||||| |
|
|
| T |
10898717 |
gcaggtgaacaatgctggtgttaatttcaatctcgggtctgataactctgttgaaaatgctcgcaaggttattgaaacaaattatt |
10898802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University