View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4376_low_9 (Length: 250)

Name: NF4376_low_9
Description: NF4376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4376_low_9
NF4376_low_9
[»] chr1 (1 HSPs)
chr1 (1-238)||(4776065-4776302)


Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 4776065 - 4776302
Alignment:
1 ccattggagatggtggatttgagatagcgcaatactctcttcaaggcttgcatatctgtcacagtaggagcttgcatttgttatgctagtttattcactg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4776065 ccattggagatggtggatttgagatagcgcaatactctcttcaaggcttgcatatctgtcacagtaggagcttgcatttgttatgctagtttattcactg 4776164  T
101 gaaatgctatgtctgggcgagtgattgaaaggtagtgtaaggcaccaagtatactgcgaaattccttactgtcacagtatgtggagtcgggtttaggttg 200  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
4776165 gaaatgcaatgtctgggcgagtgattgaaaggtagtgtaaggcaccaagcatactgcgaaattccttactgtcacagtatgtggagtcgggtttaggttg 4776264  T
201 tgagcagaatgaggtggccatgggagtagacacaggtt 238  Q
    ||||||||||||||||||||||||||||||||||||||    
4776265 tgagcagaatgaggtggccatgggagtagacacaggtt 4776302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University