View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4376_low_9 (Length: 250)
Name: NF4376_low_9
Description: NF4376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4376_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 4776065 - 4776302
Alignment:
Q |
1 |
ccattggagatggtggatttgagatagcgcaatactctcttcaaggcttgcatatctgtcacagtaggagcttgcatttgttatgctagtttattcactg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4776065 |
ccattggagatggtggatttgagatagcgcaatactctcttcaaggcttgcatatctgtcacagtaggagcttgcatttgttatgctagtttattcactg |
4776164 |
T |
 |
Q |
101 |
gaaatgctatgtctgggcgagtgattgaaaggtagtgtaaggcaccaagtatactgcgaaattccttactgtcacagtatgtggagtcgggtttaggttg |
200 |
Q |
|
|
||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4776165 |
gaaatgcaatgtctgggcgagtgattgaaaggtagtgtaaggcaccaagcatactgcgaaattccttactgtcacagtatgtggagtcgggtttaggttg |
4776264 |
T |
 |
Q |
201 |
tgagcagaatgaggtggccatgggagtagacacaggtt |
238 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |
|
|
T |
4776265 |
tgagcagaatgaggtggccatgggagtagacacaggtt |
4776302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University