View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4378-Insertion-10 (Length: 79)
Name: NF4378-Insertion-10
Description: NF4378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4378-Insertion-10 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 62; Significance: 2e-27; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 62; E-Value: 2e-27
Query Start/End: Original strand, 6 - 79
Target Start/End: Original strand, 2327455 - 2327527
Alignment:
Q |
6 |
cataaacttaggtgcttaactaactatataagtgaaaagaataatgtttacgagacttatctcaaaatacaaca |
79 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
T |
2327455 |
cataaacttaggtgcttaactaactatataagtgaaaagaataatg-ttatgagacttatctcaaaatacaaca |
2327527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University