View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4380-Insertion-7 (Length: 133)
Name: NF4380-Insertion-7
Description: NF4380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4380-Insertion-7 |
 |  |
|
| [»] chr5 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 61; Significance: 1e-26; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 61; E-Value: 1e-26
Query Start/End: Original strand, 65 - 133
Target Start/End: Original strand, 23293388 - 23293456
Alignment:
| Q |
65 |
ttataattaattgtttaaatgttttaatatatcagataacctcacataatctcttctattcctttcaca |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
23293388 |
ttataattaattgtttaaatgttttaatatatcagataacctcacagagtctcttctattcctttcaca |
23293456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 8 - 51
Target Start/End: Original strand, 23293352 - 23293395
Alignment:
| Q |
8 |
tgtttacatgtaattgcattgttttacgtatatatgttataatt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23293352 |
tgtttacatgtaattgcattgttttacgtatatatgttataatt |
23293395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 28; E-Value: 0.0000007
Query Start/End: Original strand, 94 - 133
Target Start/End: Complemental strand, 23135252 - 23135213
Alignment:
| Q |
94 |
tatcagataacctcacataatctcttctattcctttcaca |
133 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
23135252 |
tatcagataacctcacccaagctcttctattcctttcaca |
23135213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University