View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4380_high_3 (Length: 379)
Name: NF4380_high_3
Description: NF4380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4380_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 11 - 369
Target Start/End: Complemental strand, 5665546 - 5665189
Alignment:
Q |
11 |
attattcttagaacaactacatgaaaataaaaacaactacattagtgataagaaaagtgcataatcacataaaatttgggccaaacccggaagtgtcatg |
110 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5665546 |
attatttttagaacaactacatgaaaataaaaacaactacattagtgataagaaaagtgcataatcacataaaatttgggccaaacccggaagtgtcatg |
5665447 |
T |
 |
Q |
111 |
ctggtcgaccatgatattgtcgaactcctcctcctttccctggtcaaagtcctcctcctcaatctattgctccctttaggcagctatatccgtctgctcc |
210 |
Q |
|
|
||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
5665446 |
ctggtcgaccatgatattgtcaaactcctcctcctttccatggtcaaagtcctcctcctcaatctattgctccctttaggcagctatatctgtctgctcc |
5665347 |
T |
 |
Q |
211 |
cgaaaaataaccccttatcctctcctttgtaccaaacctctcaaaagaccctctaggcttctgcctattctgaaagactgcaatgctgcttcagcgaact |
310 |
Q |
|
|
|| |||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||| |||| |
|
|
T |
5665346 |
cg-aaaataaccccttaccctcttctttgtaccaaacctctcaaaagaccctctaggcttctgcctattctgcaagactgcaacgctgcttcagcaaact |
5665248 |
T |
 |
Q |
311 |
gctgagagaaatgtggtggctcaatgtacaactgagatgatgcttcttgcatccaattt |
369 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5665247 |
gctgagagaaatgtggtggctcaatgtacaactgagatgatgcttcttgcatccaattt |
5665189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University