View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4381-Insertion-16 (Length: 251)
Name: NF4381-Insertion-16
Description: NF4381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4381-Insertion-16 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 8 - 251
Target Start/End: Complemental strand, 24489291 - 24489051
Alignment:
| Q |
8 |
gcttcctccacagtttgcaagttgccaatgatgcccatgtaagttctatataactttacatcgtgctcgtcataatttattttaagacaagtccaagaga |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
24489291 |
gcttcctccacagtttgcaagttgccaatgatgccgatgtaagttctatataactttacatcgtgctcgtcataatttatttgaagacaagtccaagaga |
24489192 |
T |
|
| Q |
108 |
aatcccagctggttaatttcaagttcaacctcttggaggaagatggcacgggaactttggttaatttcaacctcttgaagtaagtatccaacgtttcgag |
207 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24489191 |
aatccccgctggttaatttcaagttcaacctcttgaaggaagatggcacaggaactttggttaatttcaacctcttgacgtaagtatccaacgtttcgag |
24489092 |
T |
|
| Q |
208 |
tatggggcagccagcagcgaggaagacagccattgattccacaa |
251 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||| ||||||| |
|
|
| T |
24489091 |
tatggggcagc---cagcgaggaagacaaccattgaatccacaa |
24489051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 131 - 168
Target Start/End: Complemental strand, 17772413 - 17772376
Alignment:
| Q |
131 |
ttcaacctcttggaggaagatggcacgggaactttggt |
168 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
17772413 |
ttcaacctcttggaggaaggtggcacgggaactttggt |
17772376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University