View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4381_high_40 (Length: 308)
Name: NF4381_high_40
Description: NF4381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4381_high_40 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 9 - 293
Target Start/End: Original strand, 9807156 - 9807440
Alignment:
| Q |
9 |
gacatcatcgttttaggtttgagttccgctagtgctctttgaggaagaaaaatgtaaattcatttacatgtgctctttgagttcgaaggtatttcctgcc |
108 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9807156 |
gacatcatagttttaagtttgagttccgctagtgctctttgaggaagaaaaatgtaaattcatttacatgtgttctttgagttcgaaggtatttcctgcc |
9807255 |
T |
 |
| Q |
109 |
ttagattggacatcaaagttttaactaccaacactaacttgctattcgtaccacttgctccctaaattgtatcgttttaatgatgatcaaatgtccacgt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
9807256 |
ttagattggacatcaaagttttaactaccaacactaacttgctattcgtaccacttgctccctaaattgtatcgttttaatgatgatcaaatgtccatgt |
9807355 |
T |
 |
| Q |
209 |
tcgctatgataaaatgagtatttggcaatagaggaacatctagtttgggatggcaaacatgaatcggttgacagcatgattattc |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9807356 |
tcgctatgataaaatgagtatttggcaatagaggaacatctagtttgggatggcaaacatgaatcggttgacagcatgattattc |
9807440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University