View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4381_high_47 (Length: 284)
Name: NF4381_high_47
Description: NF4381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4381_high_47 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 17 - 65
Target Start/End: Complemental strand, 26443075 - 26443027
Alignment:
| Q |
17 |
aacattaaccaactatatttttagatgatttgatattcccttaaaaata |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
26443075 |
aacattaaccaactatatttttagatgatttgacattcccttaaaaata |
26443027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 17 - 69
Target Start/End: Complemental strand, 22783770 - 22783719
Alignment:
| Q |
17 |
aacattaaccaactatatttttagatgatttgatattcccttaaaaatagcag |
69 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
22783770 |
aacattaaccaactatatttttagatga-ttgacattcccttaaaaatagcag |
22783719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 17 - 66
Target Start/End: Original strand, 14837968 - 14838016
Alignment:
| Q |
17 |
aacattaaccaactatatttttagatgatttgatattcccttaaaaatag |
66 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
14837968 |
aacattaaccaactatatttttagatga-ttgacattcccttaaaaatag |
14838016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 17 - 69
Target Start/End: Complemental strand, 6221982 - 6221931
Alignment:
| Q |
17 |
aacattaaccaactatatttttagatgatttgatattcccttaaaaatagcag |
69 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
6221982 |
aacattaaccaactatatttttagatga-ttgacattcccttaaaaatagcag |
6221931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 17 - 66
Target Start/End: Complemental strand, 27963722 - 27963674
Alignment:
| Q |
17 |
aacattaaccaactatatttttagatgatttgatattcccttaaaaatag |
66 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
27963722 |
aacattaaccaactatatttttagatga-ttgacattcccttaaaaatag |
27963674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 30 - 65
Target Start/End: Complemental strand, 39274589 - 39274554
Alignment:
| Q |
30 |
tatatttttagatgatttgatattcccttaaaaata |
65 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39274589 |
tatatttttagatgatttgacattcccttaaaaata |
39274554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 236 - 274
Target Start/End: Complemental strand, 21037565 - 21037527
Alignment:
| Q |
236 |
ttgccccagtagtactgtagctaataggcctgatgatgt |
274 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
21037565 |
ttgccccagtagtactgttgctaataggcctgatgatgt |
21037527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University