View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4381_high_52 (Length: 276)
Name: NF4381_high_52
Description: NF4381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4381_high_52 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 260
Target Start/End: Original strand, 2531901 - 2532160
Alignment:
| Q |
1 |
tcaaaacaattggggatagttttccttcttttatgattatttgttttggtacatatgcatgtgacaagggaccagcaacaacaaataatttcgaaggaca |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2531901 |
tcaaaacaattggtgatagttttccttcttttatgattatttgttttggtacatatgcatgtgacaagggaccagcaacaacaaataatttcgaaggaca |
2532000 |
T |
|
| Q |
101 |
ggtatgtccttaaattcgtcactcaaaaattaatattaatatatattacttattaaatcctaccatttcaatgttgtttgtcaatagtactattatagta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2532001 |
ggtatgtccttaaattcgtcactcaaaaattaatattaatatatactacttattaaatcctaccatttcaatgttgtttgtcaataatactattatagta |
2532100 |
T |
|
| Q |
201 |
tctcttgagatgatatggaaatcctcacaagccatatcccttaattcataaggtcattcc |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2532101 |
tctcttgagatgatatggaaatcctcacaagccatatcccttaattcataaggttattcc |
2532160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University