View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4381_high_58 (Length: 262)
Name: NF4381_high_58
Description: NF4381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4381_high_58 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 26 - 250
Target Start/End: Original strand, 41846387 - 41846611
Alignment:
| Q |
26 |
ggagaagaatactgagaggaaggagctcttcctgtcaaaatttccaacaccaatactccaaaagcatacacgtctgcctcttgtgaaagcttcttagctt |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41846387 |
ggagaagaatactgagaggaaggagctcttcctgtcaaaacttccaacaccaatactccaaaagcatacacgtctgcctcttgtgaaagcttcttagctt |
41846486 |
T |
 |
| Q |
126 |
ccgcctgttctggagccctgtacccacccagccttgcaactgcgtgagcagggtttaataatagtgacaaaccaaagtcacctatgcaagcaaccccatt |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41846487 |
ccgcctgttctggagccctgtacccacccagccttgcaactgcgtgagcagggtttaataacagtgacaaaccaaagtcacctatgcaagcaaccccatt |
41846586 |
T |
 |
| Q |
226 |
cttgtcaagtatcacatttgatgat |
250 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
41846587 |
cttgtcaagtatcacatttgatgat |
41846611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 130 - 250
Target Start/End: Complemental strand, 26890507 - 26890387
Alignment:
| Q |
130 |
ctgttctggagccctgtacccacccagccttgcaactgcgtgagcagggtttaataatagtgacaaaccaaagtcacctatgcaagcaaccccattcttg |
229 |
Q |
| |
|
|||||| || || ||||||||||||| | |||| ||| ||| |||||||||| | ||||||||| ||||||||| |||||||||||| || |||||| |
|
|
| T |
26890507 |
ctgttcaggtgctctgtacccacccaatcgtgcagttgcatgaacagggtttaacagtagtgacaacccaaagtcagatatgcaagcaacaccgttcttg |
26890408 |
T |
 |
| Q |
230 |
tcaagtatcacatttgatgat |
250 |
Q |
| |
|
||||||| ||||| |||||| |
|
|
| T |
26890407 |
tcaagtagtacattggatgat |
26890387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University