View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4381_high_68 (Length: 236)
Name: NF4381_high_68
Description: NF4381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4381_high_68 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 17 - 227
Target Start/End: Complemental strand, 28019726 - 28019516
Alignment:
| Q |
17 |
ttccatacatatattcttctgtatcatcattcatggcaatggcagcagagaaaatcaacaacacaaaccaaatcactgaaaccaatcatcagcagcagga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28019726 |
ttccatacatatattcttctgtatcatcattcatggcaatggcagcagagaaaatcaacaacacaaaccaaatcactgaaaccaatcatcagcagcagga |
28019627 |
T |
 |
| Q |
117 |
agaacaaacttgttttccctgcaagacttttgttcagaaatgtgataattttgtaaagaatcagagggcaaagttctacatttttcgccgttgcattatg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28019626 |
agaacaaacttgttttccctgcaagacttttgttcagaaatgtgatcattttgtaaagaatcagagggcaaagttctacatttttcgccgttgcattatg |
28019527 |
T |
 |
| Q |
217 |
atgcttctgtg |
227 |
Q |
| |
|
|||||||||| |
|
|
| T |
28019526 |
ttgcttctgtg |
28019516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University