View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4381_high_70 (Length: 229)
Name: NF4381_high_70
Description: NF4381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4381_high_70 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 18 - 211
Target Start/End: Original strand, 1573575 - 1573769
Alignment:
| Q |
18 |
ataacatgctgaaattacatcaatttgccaaagctgaaatgcattgcaaaatgttggatagagcaattcataaaatcttgtacacannnnnnn-cttcag |
116 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
1573575 |
ataacatactgaaattacatcaatttgccaaagctgaaatgcattgcaaaatgtttgatagagcaattcataaaaccttgtacacaatttttttcttcag |
1573674 |
T |
|
| Q |
117 |
acaattccaagaacagtgctttttgatcagaagactggaactaatttgcttcaatggccagtagaagaagtagaaagcttaagactgagcagtga |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1573675 |
acaattccaagaacagtgctttttgatcagaagactggaactaatttgcttcaatggccagtagaagaagtagaaagcttaagactgagtagtga |
1573769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University