View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4381_high_72 (Length: 227)

Name: NF4381_high_72
Description: NF4381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4381_high_72
NF4381_high_72
[»] scaffold0011 (1 HSPs)
scaffold0011 (1-214)||(242665-242878)
[»] chr4 (1 HSPs)
chr4 (1-104)||(47013814-47013917)
[»] chr3 (1 HSPs)
chr3 (28-129)||(49575397-49575498)


Alignment Details
Target: scaffold0011 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: scaffold0011
Description:

Target: scaffold0011; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 242665 - 242878
Alignment:
1 tggttgcttattgcattttcttggtcagtgattaaggatactgttacaccactcaatttgattggttatggacttgcatttttgggggttgcttattata 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
242665 tggttgcttattgcattttcttggtcagtgattaaggatactgttacaccactcaatttgattggttatggacttgcatttttgggggttgcttattata 242764  T
101 atcactgtaagttggtggcacttaaggcttctgaggtacaaaaggtcagggttcagcaggaagatgattctgaggctgggaaattgttggaagagagaga 200  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
242765 atcactgtaagttggtggcacttaaggcttctgaggcacaaaaggtcagggttcagcaggaagatgattctgaggctgggaaattgttggaagagagaga 242864  T
201 tgggaaagatgatg 214  Q
    ||||||||||||||    
242865 tgggaaagatgatg 242878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 104
Target Start/End: Complemental strand, 47013917 - 47013814
Alignment:
1 tggttgcttattgcattttcttggtcagtgattaaggatactgttacaccactcaatttgattggttatggacttgcatttttgggggttgcttattata 100  Q
    |||||| | |||||||| || ||||| ||||||||||||||||| |||||  | |||||||||||||||||  | || |||||||||||||| |||||||    
47013917 tggttgttgattgcattctcgtggtcggtgattaaggatactgtgacaccgattaatttgattggttatgggttggcgtttttgggggttgcgtattata 47013818  T
101 atca 104  Q
    ||||    
47013817 atca 47013814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 28 - 129
Target Start/End: Original strand, 49575397 - 49575498
Alignment:
28 gtgattaaggatactgttacaccactcaatttgattggttatggacttgcatttttgggggttgcttattataatcactgtaagttggtggcacttaagg 127  Q
    |||||||||||||||||||||||  | |||||| |||| ||||| ||||| || ||||| || |||||||||||||| |  ||||||  |||||||||||    
49575397 gtgattaaggatactgttacacccattaatttgtttgggtatggtcttgctttcttgggtgtggcttattataatcattcaaagttgcaggcacttaagg 49575496  T
128 ct 129  Q
    ||    
49575497 ct 49575498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University