View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4381_high_72 (Length: 227)
Name: NF4381_high_72
Description: NF4381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4381_high_72 |
 |  |
|
| [»] scaffold0011 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0011 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 242665 - 242878
Alignment:
| Q |
1 |
tggttgcttattgcattttcttggtcagtgattaaggatactgttacaccactcaatttgattggttatggacttgcatttttgggggttgcttattata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
242665 |
tggttgcttattgcattttcttggtcagtgattaaggatactgttacaccactcaatttgattggttatggacttgcatttttgggggttgcttattata |
242764 |
T |
 |
| Q |
101 |
atcactgtaagttggtggcacttaaggcttctgaggtacaaaaggtcagggttcagcaggaagatgattctgaggctgggaaattgttggaagagagaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
242765 |
atcactgtaagttggtggcacttaaggcttctgaggcacaaaaggtcagggttcagcaggaagatgattctgaggctgggaaattgttggaagagagaga |
242864 |
T |
 |
| Q |
201 |
tgggaaagatgatg |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
242865 |
tgggaaagatgatg |
242878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 104
Target Start/End: Complemental strand, 47013917 - 47013814
Alignment:
| Q |
1 |
tggttgcttattgcattttcttggtcagtgattaaggatactgttacaccactcaatttgattggttatggacttgcatttttgggggttgcttattata |
100 |
Q |
| |
|
|||||| | |||||||| || ||||| ||||||||||||||||| ||||| | ||||||||||||||||| | || |||||||||||||| ||||||| |
|
|
| T |
47013917 |
tggttgttgattgcattctcgtggtcggtgattaaggatactgtgacaccgattaatttgattggttatgggttggcgtttttgggggttgcgtattata |
47013818 |
T |
 |
| Q |
101 |
atca |
104 |
Q |
| |
|
|||| |
|
|
| T |
47013817 |
atca |
47013814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 28 - 129
Target Start/End: Original strand, 49575397 - 49575498
Alignment:
| Q |
28 |
gtgattaaggatactgttacaccactcaatttgattggttatggacttgcatttttgggggttgcttattataatcactgtaagttggtggcacttaagg |
127 |
Q |
| |
|
||||||||||||||||||||||| | |||||| |||| ||||| ||||| || ||||| || |||||||||||||| | |||||| ||||||||||| |
|
|
| T |
49575397 |
gtgattaaggatactgttacacccattaatttgtttgggtatggtcttgctttcttgggtgtggcttattataatcattcaaagttgcaggcacttaagg |
49575496 |
T |
 |
| Q |
128 |
ct |
129 |
Q |
| |
|
|| |
|
|
| T |
49575497 |
ct |
49575498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University