View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4381_high_78 (Length: 219)
Name: NF4381_high_78
Description: NF4381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4381_high_78 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 2 - 163
Target Start/End: Original strand, 36878628 - 36878789
Alignment:
| Q |
2 |
ttttccatttatgggtatcatctacaaggaatgatgtaccgatatgcatagctgagtgttagaggagattgtcaggaaaaatgatgtgttcttatgtctt |
101 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36878628 |
ttttcaatttatgggtatcatctacaaggaatgatgtaccgataagcatagctgagtgttagaggagattgtcaggaaaaatgatgtgttcttatgtctt |
36878727 |
T |
 |
| Q |
102 |
ccatagcatatataatcatggcatatgtgatttcttgatggtgaagttttttcaaacaactt |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36878728 |
ccatagcatatataatcatggcatatgtgatttcttgacggtgaagttttttcaaacaactt |
36878789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 2 - 127
Target Start/End: Original strand, 36878073 - 36878198
Alignment:
| Q |
2 |
ttttccatttatgggtatcatctacaaggaatgatgtaccgatatgcatagctgagtgttagaggagattgtcaggaaaaatgatgtgttcttatgtctt |
101 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||| || ||| ||| |||||||||||||| |||||||||||||||||| ||| |||| ||||||| |
|
|
| T |
36878073 |
ttttccatctatgggtatcatctacaataaatgatgtgccaataagcacagctgagtgttagaatagattgtcaggaaaaatgttgtattctcatgtctt |
36878172 |
T |
 |
| Q |
102 |
ccatagcatatataatcatggcatat |
127 |
Q |
| |
|
|| | ||||||||||||| ||||||| |
|
|
| T |
36878173 |
ccttggcatatataatcacggcatat |
36878198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 169 - 201
Target Start/End: Original strand, 36878891 - 36878923
Alignment:
| Q |
169 |
cgtcgaattgtaactgctgctgagcatcctcat |
201 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
36878891 |
cgtcgaattgtaactgctgccgagcatcctcat |
36878923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University