View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4381_high_82 (Length: 213)
Name: NF4381_high_82
Description: NF4381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4381_high_82 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 14 - 198
Target Start/End: Complemental strand, 303850 - 303652
Alignment:
| Q |
14 |
catcatctgttggtctttctgacacttcctcacacgtttctctagtttttctgcaaattaacnnnnnnn--------------tgttcatattcctagct |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
303850 |
catcatctgttggtctttctgacacttcctcacacgtttctctagtttttctgcaaattaaccatgatcaataaataaaaaaatgttcatattcctagct |
303751 |
T |
 |
| Q |
100 |
agcaaacaattaacatgattgtttttaatgattagtaccttcttttgtgagatcctctagcaccaggggtggaattagtcttgcaactatcttgagagt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
303750 |
agcaaacaattaacatgattgtttttaatgattagtaccttcttttgtgagatcctctagcaccaggggtggaattagtcttgcaactatcttgagagt |
303652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University