View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4381_high_84 (Length: 206)
Name: NF4381_high_84
Description: NF4381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4381_high_84 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 2e-94; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 183
Target Start/End: Complemental strand, 2564865 - 2564683
Alignment:
| Q |
1 |
tggtcattaaaatcagggcctccaacaatagcacccacatgaatattaggatttggattagaggaatagaaataatctgtgtaaccatcattgcaaccca |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2564865 |
tggtcattaaaatcagggcctccaactatagcacccacatgaatattaggatttggattagaggaatagaaataatctgtgtaaccatcattgcaaccca |
2564766 |
T |
 |
| Q |
101 |
ctttggtctggtgaagtttgattgaagggatggaagaacctctgtgatgtaattgctttggatatttacttccatatcccacc |
183 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2564765 |
ctttggtctggtgaactttgattgaagggatggaagaacctctgtgatgtaattgctttggatatttacttccatatcccacc |
2564683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 1 - 183
Target Start/End: Complemental strand, 2574759 - 2574577
Alignment:
| Q |
1 |
tggtcattaaaatcagggcctccaacaatagcacccacatgaatattaggatttggattagaggaatagaaataatctgtgtaaccatcattgcaaccca |
100 |
Q |
| |
|
||||||||| ||| || |||||||||||||||||||||||||||||||||||||||||||| || ||||||| | | | |||||||||||||||| |
|
|
| T |
2574759 |
tggtcattagaatttggtcctccaacaatagcacccacatgaatattaggatttggattagatgatgagaaatagttcgattggccatcattgcaaccca |
2574660 |
T |
 |
| Q |
101 |
ctttggtctggtgaagtttgattgaagggatggaagaacctctgtgatgtaattgctttggatatttacttccatatcccacc |
183 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
2574659 |
ctttggtctggtgaactttgattgaagggatggaagaacctctgtgatgtaattgttttggatatttactcccatatcccacc |
2574577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University