View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4381_low_52 (Length: 286)
Name: NF4381_low_52
Description: NF4381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4381_low_52 |
 | |
|
| [»] scaffold0060 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0060 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 41 - 273
Target Start/End: Complemental strand, 63924 - 63697
Alignment:
| Q |
41 |
tttgatcgatttgaagagattttaggaggctaaaggggttgttgagaagatggttttgaaaggttttgtggtgagttatgattcttttaagggtttggtt |
140 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
63924 |
tttgattgatttgaagagattttaggaggctaaaggggttgttgagaagatggttttgaaaggtttagtggtgagttatgattcttttaagggtttggtt |
63825 |
T |
|
| Q |
141 |
ttggggttttgtagagagggtttggttgaggatgttgattggggtgttaggagtgtggttaggatggtgggatttgttgttaagatggggatgtggagac |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| |||||||||||| | |
|
|
| T |
63824 |
ttggggttttgtagagagggtttggttgaggatgttgattggggtgttaggagtatggttgggatggtgggatttgttgtta----ggggatgtggagtc |
63729 |
T |
|
| Q |
241 |
aaattgttaagtttgttgttgtttctagtgatg |
273 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
63728 |
aaattgttaagtttg-tgttgtttctagtgatg |
63697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 152; Significance: 2e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 20 - 273
Target Start/End: Original strand, 30300979 - 30301229
Alignment:
| Q |
20 |
ttatcaacatattttgtatgatttgatcgatttgaagagattttaggaggctaaaggggttgttgagaagatggttttgaaaggttttgtggtgagttat |
119 |
Q |
| |
|
|||||| ||| | ||||||| |||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30300979 |
ttatcagcatgtgttgtatggtttgattgatttgaagagatttgaggaggctaaaggggttgttgagaagatggttttgaagggttttgtggtgagttat |
30301078 |
T |
|
| Q |
120 |
gattcttttaagggtttggttttggggttttgtagagagggtttggttgaggatgttgattggggtgttaggagtgtggttaggatggtgggatttgttg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || ||| ||||||| ||||||||||||||||||||| ||||||||| |||| |||||| |
|
|
| T |
30301079 |
gattcttttaagggtttggttttggggttttgtagagaagggttgattgaggaagttgattggggtgttaggagtatggttagga---tgggttttgttc |
30301175 |
T |
|
| Q |
220 |
ttaagatggggatgtggagacaaattgttaagtttgttgttgtttctagtgatg |
273 |
Q |
| |
|
|| ||||||||||||||||| |||||||| | | ||||||||||||| |||| |
|
|
| T |
30301176 |
ctaggatggggatgtggagaccaattgttagatgtattgttgtttctagagatg |
30301229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University