View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4381_low_66 (Length: 267)
Name: NF4381_low_66
Description: NF4381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4381_low_66 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 261
Target Start/End: Complemental strand, 6937128 - 6936867
Alignment:
| Q |
1 |
cgagtttgatgaaatcacagtgatgtcgtgattttgttgaagcatctagctttttacaaaatcacggtggcacactgtaatcatgtcagacctcattgtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6937128 |
cgagtttgatgaaatcacagtgatgtcgtgattttgttgaagcatctagctttttacaaaatcacggtggcacaatgtaatcatgtcagacctcattgtc |
6937029 |
T |
|
| Q |
101 |
aatccaaacatgcactaatttggtgaatattccatctggtctattagggatatcataattttcactatcatgggatatgcttatttcttttaccatgcaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6937028 |
aatccaaacatgcactaatttggtgaatattccatttggtctattagggatatcataattttcactatcatgggatatgcttatttcttttaccatgcaa |
6936929 |
T |
|
| Q |
201 |
tttttgtggataatacaaattactaggtatgaagtt-atgactaattgactatattcttgga |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
6936928 |
tttttgtggataatacaaattactaggtatgaagttaatgactaattgactatatttttgga |
6936867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University