View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4381_low_68 (Length: 257)
Name: NF4381_low_68
Description: NF4381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4381_low_68 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 46 - 247
Target Start/End: Original strand, 43533818 - 43534019
Alignment:
| Q |
46 |
gtaaaatgaataaataataaccctactcacataactttgaattgaatatataaattgattcatatctttatcttttttaaaatatatatgcaaataaggt |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43533818 |
gtaaaatgaataaataataaccctactcacataactttgaattgaatatataaattgactcatatctttatattttttaaaatatatatgcaaataaggt |
43533917 |
T |
|
| Q |
146 |
acaacaatcccttatcaaggatcgacttaagctcgcaatgacattacacgctttatttagtttgctatgagatttgtcaccaagataatcactcaagaat |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43533918 |
acaacaatcccttatcaaggatcgacttaagctcgcaatgacattacacgctttatttagtttgctatgagatttgtcaccaagataatcactcaagaat |
43534017 |
T |
|
| Q |
246 |
aa |
247 |
Q |
| |
|
|| |
|
|
| T |
43534018 |
aa |
43534019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 186 - 248
Target Start/End: Original strand, 43531668 - 43531730
Alignment:
| Q |
186 |
acattacacgctttatttagtttgctatgagatttgtcaccaagataatcactcaagaataat |
248 |
Q |
| |
|
||||||||| |||||||||||| ||||| |||||||| |||||||||||||| |||||||| |
|
|
| T |
43531668 |
acattacacactttatttagttcactatgtgatttgtccccaagataatcacttgagaataat |
43531730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University