View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4381_low_69 (Length: 252)
Name: NF4381_low_69
Description: NF4381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4381_low_69 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 11 - 180
Target Start/End: Original strand, 6476414 - 6476583
Alignment:
| Q |
11 |
cacagacttgccaccatctacctctacttggctctggaaaaatgaaatgcattagaaacattacatctggggatgaatctatcttacacatgataccaag |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
6476414 |
cacagacttgccaccatctacctctacttggctctggaaaaatgaaatgcattagaaacattacatctagggatgaacctatcttacacatgataccaag |
6476513 |
T |
 |
| Q |
111 |
gtgagattgttaccaataggggaccaaaagattgaaacttagtccagtgccttatatcatcctctggtct |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6476514 |
gtgagattgttaccaataggggaccaaaagattgaaacttagtccagtgccttatatcatcctctggtct |
6476583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 208 - 252
Target Start/End: Original strand, 6476611 - 6476655
Alignment:
| Q |
208 |
tgttagtatttttgtagaataatgaggcaatttaatttaatattt |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6476611 |
tgttagtatttttgtagaataatgaggcaatttaatttaatattt |
6476655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University