View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4381_low_70 (Length: 248)
Name: NF4381_low_70
Description: NF4381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4381_low_70 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 30 - 230
Target Start/End: Complemental strand, 10468599 - 10468399
Alignment:
| Q |
30 |
atagacccaccatttcaatgataatttggatatttacaaaaagttaaaaatttatatttttgggtttgtaatacgttagtcagaaattgaaaatgggttt |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10468599 |
atagacccaccatttcaatgataatttggatatttacaaaaagttcaaaatttatatttttgggtttgtaatacattagtcagaaattgaaaatgggttt |
10468500 |
T |
 |
| Q |
130 |
atttgaagaaaaaggaagaagtaggataactttttagggaccattgtgattgtgtgtatgatttgttcacttgttaaatttgtgtacatgttttgtctct |
229 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10468499 |
atttcaagaaaaaggaagaagtaggatagctttttagggaccattgtgattgtgtgtatgatttgttcacttgttaaatttgtgtacatgttttgtctct |
10468400 |
T |
 |
| Q |
230 |
g |
230 |
Q |
| |
|
| |
|
|
| T |
10468399 |
g |
10468399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University