View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4381_low_77 (Length: 237)
Name: NF4381_low_77
Description: NF4381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4381_low_77 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 36604902 - 36604677
Alignment:
| Q |
1 |
atttaagtgatttatgttttgatgtgtgaaattttcagtggaagacaannnnnnnnnnn---gattacttatagttaaattgagctttggaataatcaat |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
36604902 |
atttaagtgatttatgttttgatgtgtgaaattttcagtggaagacaattttttttttttttgattacttatagttaaatcgagctttggaataatcaat |
36604803 |
T |
 |
| Q |
98 |
tttgattcatatgaccgtatgtttgacattgaggcaaaattgtggtgaacatgccttaaaaacaggatttttatggtttctggcatggaagattccaatc |
197 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36604802 |
tttgattcatatgaccgaatgtttgacattgaggcaaaattgtggtgaacatgtcttaaaaacaggatttttatggtttctggcatggaagattccaatc |
36604703 |
T |
 |
| Q |
198 |
atgcttctgttttttgtctcgtgatg |
223 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
36604702 |
atgcttctgttttttgtctcgtgatg |
36604677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University