View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4381_low_81 (Length: 229)
Name: NF4381_low_81
Description: NF4381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4381_low_81 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 16 - 213
Target Start/End: Complemental strand, 53819181 - 53818984
Alignment:
| Q |
16 |
acagatcaattgaacaaaatttgctaaaattaaaattgtgtcatcaagggtatactgtaattagatgaagatctaaatgttctccatcagtgataaaatt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
53819181 |
acagatcaattgaacaaaatttgctaaaattaaaattgtgtcatcaagggtatactgtaattagatgaagatctaaatgttatccatcagtgataaaatt |
53819082 |
T |
 |
| Q |
116 |
gttagaacaaaattactttatgaacaatcaaaacaaccatagaatattatacaaattaaataccttggaaacattccaggtagaggtgatcttgtagt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53819081 |
gttagaacaaaattactttatgaacaatcaaaacaaccatagaatattatacaaattaaataccttggaaacattccaggtagaggtgatcttgtagt |
53818984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University