View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4381_low_89 (Length: 218)
Name: NF4381_low_89
Description: NF4381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4381_low_89 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 134; Significance: 6e-70; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 62 - 195
Target Start/End: Complemental strand, 10408574 - 10408441
Alignment:
| Q |
62 |
ctaattaaagccattactcttccttctatacggcagatgtgtttgataaaaaatcatatatgttctctctcaaattttaagattttggcttatgtatgtt |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10408574 |
ctaattaaagccattactcttccttctatacggcagatgtgtttgataaaaaatcatatatgttctctctcaaattttaagattttggcttatgtatgtt |
10408475 |
T |
 |
| Q |
162 |
gcatccaatatgtagacgtgtcggtctcttgagt |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
10408474 |
gcatccaatatgtagacgtgtcggtctcttgagt |
10408441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 10408644 - 10408601
Alignment:
| Q |
1 |
atagttttccaacctgactttaaatgtgtacgggtcatctaatt |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10408644 |
atagttttccaacctgactttaaatgtgtacgggtcatctaatt |
10408601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University