View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4383-Insertion-11 (Length: 360)

Name: NF4383-Insertion-11
Description: NF4383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4383-Insertion-11
NF4383-Insertion-11
[»] chr8 (1 HSPs)
chr8 (57-108)||(6085028-6085079)


Alignment Details
Target: chr8 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 57 - 108
Target Start/End: Complemental strand, 6085079 - 6085028
Alignment:
57 atgaagaggtatccagtttcattgaatcaagtgacacatgtggtggggagtc 108  Q
    |||| ||||||| ||||| |||||||||||||||||||||||||||||||||    
6085079 atgaggaggtatgcagttacattgaatcaagtgacacatgtggtggggagtc 6085028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University