View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4383-Insertion-11 (Length: 360)
Name: NF4383-Insertion-11
Description: NF4383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4383-Insertion-11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 57 - 108
Target Start/End: Complemental strand, 6085079 - 6085028
Alignment:
Q |
57 |
atgaagaggtatccagtttcattgaatcaagtgacacatgtggtggggagtc |
108 |
Q |
|
|
|||| ||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
6085079 |
atgaggaggtatgcagttacattgaatcaagtgacacatgtggtggggagtc |
6085028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University