View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4384_high_4 (Length: 309)
Name: NF4384_high_4
Description: NF4384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4384_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 7e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 7e-89
Query Start/End: Original strand, 6 - 200
Target Start/End: Original strand, 40993992 - 40994194
Alignment:
| Q |
6 |
agaggttttggctagtcctaattagattttaattatctttttgttctcctaatttgagctcttgattattctattctatgttacaataacacgtctctac |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40993992 |
agaggttttggctagtcctaattagattttaattatctttttgttctcctaatttgagctcttgattattctattctatgttacaataacacgtctctaa |
40994091 |
T |
 |
| Q |
106 |
tttaagttggtggagctagttaattaagtcatgagatggttggttggc--------atatatagtcaaagtcaagtcaacccctgccacatgtggaattt |
197 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40994092 |
tttaagttggtggagctaattaattaagtcatgagatggttggttggcatatatatatatatagtcaaagtcaagtcaacccctgccacatgtggaattt |
40994191 |
T |
 |
| Q |
198 |
att |
200 |
Q |
| |
|
||| |
|
|
| T |
40994192 |
att |
40994194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University