View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4385_low_6 (Length: 217)
Name: NF4385_low_6
Description: NF4385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4385_low_6 |
 |  |
|
[»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 66 - 217
Target Start/End: Original strand, 48691339 - 48691486
Alignment:
Q |
66 |
attaagaagcgtacatgagacatagaacttgtttgatgtactgacgaataatatgaactatttattactctgagacaaaagttcccgccccattaacatc |
165 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
48691339 |
attaagaagcgtacatgagacatagaacttgtttgatgtactgacgaataatatgaa----gtattactctgagacaaaagttcccgccccattaacata |
48691434 |
T |
 |
Q |
166 |
caaaagttttactgaaaatgacatcggcaagtgagatgaaggttaactattt |
217 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48691435 |
caaaagttttactgaaaatgacatcggcaagtgagatgaaggttaactattt |
48691486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 13 - 45
Target Start/End: Original strand, 48691292 - 48691324
Alignment:
Q |
13 |
catcaagaagtgaaataatttaatttttgatcc |
45 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
48691292 |
catcaagaagtgaaataatttaatttttgatcc |
48691324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University