View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4386-Insertion-6 (Length: 216)
Name: NF4386-Insertion-6
Description: NF4386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4386-Insertion-6 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 8 - 216
Target Start/End: Complemental strand, 45316750 - 45316542
Alignment:
| Q |
8 |
gaaaataaacttaaatcaaaaaatggtctttacatgtgttgcagatgaatgcattgaaaaacttgggactgaatgttgttaaggcaagcgtgtgtctgga |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45316750 |
gaaaataaacttaaatcaaaaaatggtctttacatgtgttgcagatgaatgcattgaaaaacttgggactgaatgttgttaaggcaagcgtgtgtctgga |
45316651 |
T |
|
| Q |
108 |
ctcttctggcaagcacaacaagttttccatcacaaaggcgtaagcaatattcccgtgtattgtacatgttcgttttatggatcaaggttatgattagaat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45316650 |
ctcttctggcaagcacaacaagttttccatcacaaaggcgtaagcaatattcccgtgtattgtacatgttcgttttatggatcaaggttatgattagaat |
45316551 |
T |
|
| Q |
208 |
gtgtagtaa |
216 |
Q |
| |
|
||||||||| |
|
|
| T |
45316550 |
gtgtagtaa |
45316542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 44 - 151
Target Start/End: Complemental strand, 969899 - 969792
Alignment:
| Q |
44 |
tgttgcagatgaatgcattgaaaaacttgggactgaatgttgttaaggcaagcgtgtgtctggactcttctggcaagcacaacaagttttccatcacaaa |
143 |
Q |
| |
|
||||| |||||| ||||| ||| |||| || || ||||| || ||||||| || | ||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
969899 |
tgttgtagatgagagcattaaaagacttaggcctcaatgtcgtaaaggcaaatgtctttctcgattcttctggcaagcacaacaagttttccatcacaaa |
969800 |
T |
|
| Q |
144 |
ggcgtaag |
151 |
Q |
| |
|
||||||| |
|
|
| T |
969799 |
agcgtaag |
969792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University