View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4386-Insertion-8 (Length: 123)
Name: NF4386-Insertion-8
Description: NF4386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4386-Insertion-8 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 96; Significance: 2e-47; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 96; E-Value: 2e-47
Query Start/End: Original strand, 8 - 123
Target Start/End: Complemental strand, 3684660 - 3684545
Alignment:
| Q |
8 |
cctagtgcccaaaatcaaaggaagaatggatcaagcatactccaccagagcgaagagacacaagtgataagcaagcagactcgaacaaccccacttaaag |
107 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| |||||||||||||| |
|
|
| T |
3684660 |
cctattgcccaaaatcaaaggaagaatggatcaagcatactccaccagagcgaagagacacaagtgataaggaagcaggttcgaaaaaccccacttaaag |
3684561 |
T |
|
| Q |
108 |
acacccaaacaagcac |
123 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
3684560 |
acacccaaacaagcac |
3684545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 28; Significance: 0.0000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 28; E-Value: 0.0000006
Query Start/End: Original strand, 10 - 57
Target Start/End: Complemental strand, 15169930 - 15169884
Alignment:
| Q |
10 |
tagtgcccaaaatcaaaggaagaatggatcaagcatactccaccagag |
57 |
Q |
| |
|
|||||||||||| |||| |||||||||| |||||| |||||||||||| |
|
|
| T |
15169930 |
tagtgcccaaaa-caaacgaagaatggaccaagcaaactccaccagag |
15169884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University