View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4386_low_3 (Length: 323)
Name: NF4386_low_3
Description: NF4386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4386_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 1 - 314
Target Start/End: Complemental strand, 47698469 - 47698156
Alignment:
| Q |
1 |
ttcttcagccttttataatatgaggaagcgttgtggcaccgccagcgagcctgaaatttttcagagagaattttaatattgaatacttatgtctttaact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47698469 |
ttcttcagccttttataatatgaggaagcgttgtggcaccgccagcgagcctgaaatttttcagagagaattttaatattgaatacttatgtctttaact |
47698370 |
T |
|
| Q |
101 |
gacggtcctaattacaagagtcaactataacctgaataatggtggaagctttagtccgtttcctataattgaactccttgcgggcagcgattgccctcaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
47698369 |
gacggtcctaattacaagagtcaactataacctgaataatggtggaagctttagtccgtttcctataattgaactccttacgggcagcgattgccctcaa |
47698270 |
T |
|
| Q |
201 |
agctgtttgcaaagtaagcactgatgcatggagtttattgtaggatttcctcgattcatatttgcgtacgtgcttctgaattttcacagcagcagcctcc |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47698269 |
agctgtttgcaaagtaagcactgatgcatggagtttattgtaggatttcctcgattcatatctgcgtacgtgcttctgaattttcacagcagcagcctcc |
47698170 |
T |
|
| Q |
301 |
cttcacaggttctg |
314 |
Q |
| |
|
|||| ||||||||| |
|
|
| T |
47698169 |
cttctcaggttctg |
47698156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 52; Significance: 8e-21; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 129 - 304
Target Start/End: Original strand, 35824664 - 35824839
Alignment:
| Q |
129 |
aacctgaataatggtggaagctttagtccgtttcctataattgaactccttgcgggcagcgattgccctcaaagctgtttgcaaagtaagcactgatgca |
228 |
Q |
| |
|
||||||||||||| |||||||||| ||| |||||||| | |||| ||||||| ||||| || ||||| |||||||||||||||||||| ||||| | |
|
|
| T |
35824664 |
aacctgaataatgatggaagctttggtctgtttcctaaatctgaattccttgcaagcagcaatggcccttaaagctgtttgcaaagtaagtactgacata |
35824763 |
T |
|
| Q |
229 |
tggagtttattgtaggatttcctcgattcatatttgcgtacgtgcttctgaattttcacagcagcagcctcccttc |
304 |
Q |
| |
|
|| ||||| || || | ||||| | ||| || |||||| || ||| ||||||||||||||||| |||||||||| |
|
|
| T |
35824764 |
tgaagttttttatacgccttcctagtttcgtaactgcgtatgttcttttgaattttcacagcagcggcctcccttc |
35824839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University