View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4387_low_1 (Length: 607)
Name: NF4387_low_1
Description: NF4387
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4387_low_1 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 9e-81; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 9e-81
Query Start/End: Original strand, 416 - 592
Target Start/End: Complemental strand, 33549587 - 33549411
Alignment:
| Q |
416 |
cattttccttatttggttttggtgtcaatttaagcaataatatcttgaaagcatgcaaggacaaaggaagcagcagggggcagtgtggaatatttcaagt |
515 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
33549587 |
cattttccttatttgattttggtatcaatttaagcaataatatcttgaaagtatgcaaggacaaaggaagcagaagggggcagtgtggaatatttgaagt |
33549488 |
T |
|
| Q |
516 |
gcctgagaatgagagacgtgtttggatgtaacacccaaaccaaagaaagaggaacaagattaacacatagataaaag |
592 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33549487 |
gcctgagaatgagagacgtgtttggatgtaacacccaaaccaaagaaagaggaacaagattaacacaaagataaaag |
33549411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 106; E-Value: 1e-52
Query Start/End: Original strand, 131 - 312
Target Start/End: Complemental strand, 33549820 - 33549640
Alignment:
| Q |
131 |
gaacacaatgtttagggatatttgcaacctccctatcatgactttggtcaaatcatatcaacctgttatagggttgcgggaactttttgcggttttgaga |
230 |
Q |
| |
|
|||||| ||||||||||||| | |||||||||||||||| ||||||||||||||| |||||||| ||||||| ||| ||||||||||||||||| ||||| |
|
|
| T |
33549820 |
gaacacgatgtttagggatactcgcaacctccctatcataactttggtcaaatcagatcaacctattatagg-ttgggggaactttttgcggttatgaga |
33549722 |
T |
|
| Q |
231 |
gagatggtgataatcagattaaagactaatcaagattacacatagcgttgtatgaacgtgattaaaaacaaagtgcaagtta |
312 |
Q |
| |
|
|||||| | |||||||| |||||||||||||||||||||||||||| |||||||||| ||||| || || || ||||||||| |
|
|
| T |
33549721 |
gagatgatcataatcaggttaaagactaatcaagattacacatagcattgtatgaacatgattgaagacgaaatgcaagtta |
33549640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University