View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4387_low_10 (Length: 245)
Name: NF4387_low_10
Description: NF4387
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4387_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 19 - 227
Target Start/End: Original strand, 1451584 - 1451792
Alignment:
| Q |
19 |
aatcaaagcataaaccacaaaaggattttggaggtagtgaagaacattcacagctggtctcaatagtttctttcttcaactctttctcattacttgttac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1451584 |
aatcaaagcataaaccacaaaaggattttggaggtagtgaagaacattcacagctggtctcaatagtttctttcttcaactctttctcattacttgttac |
1451683 |
T |
|
| Q |
119 |
tgaacatttgagaatccctttcaaattttgttgttggaattcattacacttcactttcactgagttttgatttggttgatcaatggtgaatgtgactttc |
218 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1451684 |
tgaacatttgagaatccttttcaaattttgttgttggaattcattacacttcactttcactgagttttgatttggttgatcaatggtgaatgtgactttc |
1451783 |
T |
|
| Q |
219 |
ttcctcttc |
227 |
Q |
| |
|
||||||||| |
|
|
| T |
1451784 |
ttcctcttc |
1451792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 144 - 189
Target Start/End: Original strand, 1455393 - 1455438
Alignment:
| Q |
144 |
ttttgttgttggaattcattacacttcactttcactgagttttgat |
189 |
Q |
| |
|
||||||||||| |||||||| || |||||||||||| ||||||||| |
|
|
| T |
1455393 |
ttttgttgttgaaattcattgcaattcactttcactaagttttgat |
1455438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University