View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4388_low_3 (Length: 316)
Name: NF4388_low_3
Description: NF4388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4388_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 3e-97; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 18 - 201
Target Start/End: Original strand, 28094925 - 28095108
Alignment:
Q |
18 |
gatatggtttggcattgtgcgaaaggacgagagattcctggtatgccgattttgtccgttgcagaatcatgtgttccaggccaaacaatcattttgatct |
117 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28094925 |
gataaggtttggcattgtgcgaaaggacgagagattcctggtatgccgattttgtccgttgcagaatcatgtgttccaggccaaacaatcattttgatct |
28095024 |
T |
 |
Q |
118 |
taagtttgtcagggttgagatttgccatccagttttttctgtctgatgggtggtaatcacaaccagggtagttttctcctaagc |
201 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28095025 |
taagtttgtcagggttgagatttgccatccagttttttctgtctgatgggtggtaatcacaaccagggtagttttctcctaagc |
28095108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 264 - 297
Target Start/End: Original strand, 28095171 - 28095204
Alignment:
Q |
264 |
gacacctgagaacccattttctttaacatcaatg |
297 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |
|
|
T |
28095171 |
gacacctgagaacccattttctttaacatcaatg |
28095204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000007; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 78 - 197
Target Start/End: Complemental strand, 26155772 - 26155653
Alignment:
Q |
78 |
gcagaatcatgtgttccaggccaaacaatcattttgatcttaagtttgtcagggttgagatttgccatccagttttttctgtctgatgggtggtaatcac |
177 |
Q |
|
|
||||||||||||||||| ||||| ||||| ||||| | || ||| || ||||||||| ||||||||||||||| |||||||| || || ||| |
|
|
T |
26155772 |
gcagaatcatgtgttcctggccatacaatttgattgatatgaactttctctgggttgagaccattcatccagttttttctatctgatggatgatattcag |
26155673 |
T |
 |
Q |
178 |
aaccagggtagttttctcct |
197 |
Q |
|
|
|||||||||||| ||||||| |
|
|
T |
26155672 |
aaccagggtagtcttctcct |
26155653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 78 - 197
Target Start/End: Complemental strand, 26169070 - 26168951
Alignment:
Q |
78 |
gcagaatcatgtgttccaggccaaacaatcattttgatcttaagtttgtcagggttgagatttgccatccagttttttctgtctgatgggtggtaatcac |
177 |
Q |
|
|
||||||||||||||||| ||||| ||||| ||||| | || ||| || ||||||||| ||||||||||||||| |||||||| || || ||| |
|
|
T |
26169070 |
gcagaatcatgtgttcctggccatacaatttgattgatatgaactttctctgggttgagaccattcatccagttttttctatctgatggatgatattcag |
26168971 |
T |
 |
Q |
178 |
aaccagggtagttttctcct |
197 |
Q |
|
|
|||||||||||| ||||||| |
|
|
T |
26168970 |
aaccagggtagtcttctcct |
26168951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University