View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4389_high_3 (Length: 321)
Name: NF4389_high_3
Description: NF4389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4389_high_3 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 1 - 312
Target Start/End: Original strand, 32991536 - 32991849
Alignment:
| Q |
1 |
acaccatgttttgaattgtctcttaattgaattttgtttgtttcatcatgtcacaaacataaacacaccacatgtgacataatcccttatctttgttgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32991536 |
acaccatgttttgaattgtctcttaattgaattttgtttgtttcatcatgtcacaaacataaacacaccacatgtgacataatcccttatctttgttgct |
32991635 |
T |
|
| Q |
101 |
tttaaaagcattgctgcgttttgttttcataacttcaagctttgttgatttcttcctctaaatcagtaacatggatgtgaattttaagtcactttccttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32991636 |
tttaaaagcattgctgcgttttgttttcataacttcaagctttgttgatttcttcctctaaatcagtaacatggatgtgaattttaagtcactttccttt |
32991735 |
T |
|
| Q |
201 |
gaaaaatcagaagctgaacctgaagtggaagaaaacatgcactttcttaagtctcttcaggtt--tatatctactgtgttatgttcgattgtcttattat |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
32991736 |
gaaaaatcagaagctgaacctgaagtggaagaaaacatgcactttcttaagtctcttcaggttcatatatctactgtgttatgttctattttcttattat |
32991835 |
T |
|
| Q |
299 |
ggtattagtattat |
312 |
Q |
| |
|
||||||| |||||| |
|
|
| T |
32991836 |
ggtattaatattat |
32991849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University