View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4389_high_4 (Length: 233)
Name: NF4389_high_4
Description: NF4389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4389_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 3471210 - 3471424
Alignment:
| Q |
1 |
ttttaatggattttctttgacacgtgttttgttacttttattatctatcaacgtactctttatgtcttaaattataagtaaaaattggtcaaatgtgctt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
3471210 |
ttttaatggattttctttgacacgtgttttgttacttttattatctatcaacgtactctttatgtctcaaattataagtaaaaattggtcaaatatgctt |
3471309 |
T |
 |
| Q |
101 |
tggatttgaaataattcattctagaggtctagaggttactagaggattatgtgctacagaggatagcatagaggaacatcacaggatgctttggttcgtt |
200 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| || |
|
|
| T |
3471310 |
tggatttgaaataattcattctaaaggtctagaggttactagaggattatgtgctacagaggataacatagaggaacatcacaagatgctttggttcatt |
3471409 |
T |
 |
| Q |
201 |
aatctaatgtatagt |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
3471410 |
aatctaatgtatagt |
3471424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 99 - 145
Target Start/End: Original strand, 15633560 - 15633606
Alignment:
| Q |
99 |
tttggatttgaaataattcattctagaggtctagaggttactagagg |
145 |
Q |
| |
|
|||| ||||||| ||||| |||||||||||| ||||||||||||||| |
|
|
| T |
15633560 |
tttgaatttgaagtaatttattctagaggtccagaggttactagagg |
15633606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University