View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4389_low_6 (Length: 216)
Name: NF4389_low_6
Description: NF4389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4389_low_6 |
 |  |
|
| [»] scaffold0618 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0618 (Bit Score: 72; Significance: 6e-33; HSPs: 1)
Name: scaffold0618
Description:
Target: scaffold0618; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 6214 - 6143
Alignment:
| Q |
1 |
taataatatataattgttggtcatatggtttagactttagagttttataattgttatgatgtgttcggtgaa |
72 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6214 |
taataatatataattgttggtcatatggtttagactttagagttttataattgttatgatgtgttcggtgaa |
6143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 72; Significance: 6e-33; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 1 - 72
Target Start/End: Original strand, 44093697 - 44093768
Alignment:
| Q |
1 |
taataatatataattgttggtcatatggtttagactttagagttttataattgttatgatgtgttcggtgaa |
72 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44093697 |
taataatatataattgttggtcatatggtttagactttagagttttataattgttatgatgtgttcggtgaa |
44093768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University