View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4389_low_6 (Length: 216)

Name: NF4389_low_6
Description: NF4389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4389_low_6
NF4389_low_6
[»] scaffold0618 (1 HSPs)
scaffold0618 (1-72)||(6143-6214)
[»] chr8 (1 HSPs)
chr8 (1-72)||(44093697-44093768)


Alignment Details
Target: scaffold0618 (Bit Score: 72; Significance: 6e-33; HSPs: 1)
Name: scaffold0618
Description:

Target: scaffold0618; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 6214 - 6143
Alignment:
1 taataatatataattgttggtcatatggtttagactttagagttttataattgttatgatgtgttcggtgaa 72  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6214 taataatatataattgttggtcatatggtttagactttagagttttataattgttatgatgtgttcggtgaa 6143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 72; Significance: 6e-33; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 1 - 72
Target Start/End: Original strand, 44093697 - 44093768
Alignment:
1 taataatatataattgttggtcatatggtttagactttagagttttataattgttatgatgtgttcggtgaa 72  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44093697 taataatatataattgttggtcatatggtttagactttagagttttataattgttatgatgtgttcggtgaa 44093768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University