View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4390_low_6 (Length: 296)
Name: NF4390_low_6
Description: NF4390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4390_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 19 - 277
Target Start/End: Complemental strand, 37244678 - 37244420
Alignment:
Q |
19 |
cttggagctctcttgcagatcgaataatataatcttcgtctggttcctcacaatttaacaaatttcttattggtggtctgagcgagggtgttgtgtggct |
118 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
37244678 |
cttggagctctcttgcagatcgaataatataatcttcgtctggttcctcacaatttaacaaatttctcattggtggtctgagcgagggtgttgtgtggct |
37244579 |
T |
 |
Q |
119 |
tgcgttttcttgtatcatacttttcctgtacaagtccaatagatgcatacatttccccaaccttatgattttcttcttgaacaaggatgtattctcaatg |
218 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| |||| |
|
|
T |
37244578 |
tgcgttttcttgtatcatacttttcctgtacaagtccaatagatgcgtacatttccccaaccttatgatttttgtcttgaacaaggatgtattcttaatg |
37244479 |
T |
 |
Q |
219 |
attccggatggccatgggtcaagaaattttatgattttcttgtttaacgactcacgatg |
277 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
37244478 |
attcgggatggccatgggtcaagaaattttatgattttctcctttaacgactcacgatg |
37244420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 104 - 178
Target Start/End: Complemental strand, 37965258 - 37965184
Alignment:
Q |
104 |
gggtgttgtgtggcttgcgttttcttgtatcatacttttcctgtacaagtccaatagatgcatacatttccccaa |
178 |
Q |
|
|
|||||||| |||||||| | ||||||||||| ||||| || |||| |||||||| |||||| ||||||||||| |
|
|
T |
37965258 |
gggtgttgggtggcttggttcttcttgtatcactctttttctatacacgtccaatacatgcatgcatttccccaa |
37965184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University