View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4390_low_8 (Length: 225)
Name: NF4390_low_8
Description: NF4390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4390_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 23 - 214
Target Start/End: Original strand, 32196240 - 32196429
Alignment:
Q |
23 |
ttatgtatctccatgtgtgttacactaagcacttgcgtcatttctccgcatatgtcccctataaggtttctaaagagaatgatgtacccagtacaataat |
122 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
32196240 |
ttatgtatctccatgtgtgttacactaggcacttgcgtcatttctccgcatatgtcccctataaggtttctaa--agaatgatgtacccagtacaataat |
32196337 |
T |
 |
Q |
123 |
gcactagatggtgtgccacacataggaaaggagatatggacacnnnnnnnattctttccttttcactattccgaagggtcacattgtctgtg |
214 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32196338 |
gcactagatggtgtgccacacataggaaaggagatatggacactttttttattctttccttttcactattccgaagggtcacattgtctgtg |
32196429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University